Girl Guinness Litecoin Dog - Mix of French Bulldog, Shiba Inu, St. Bernard, Husky, Corgi, Beagle, Labrador and Pug

Achievements

None
Girl Guinness
I don't appreciate being around bores who bark too much. I love it when you show a little teeth. What's your favorite bed? Mine is the dirty laundry. I like never worrying about my dog poo. I've got people for that. Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 11%
  • Age 29 days
  • Racing Exp 0
  • French Bulldog 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CGATGAACAAGCCTAGTAGTACCAGAACGACGA
C
G
A
T
G
A
A
C
A
A
G
C
C
T
A
G
T
A
G
T
A
C
C
A
G
A
A
C
G
A
C
G
A
Genes: 9B4ODEE5299

Composition

French Bulldog
27%
Shiba Inu
18%
St. Bernard
9%
Husky
9%
Corgi
9%
Beagle
9%
Labrador
9%
Pug
9%

Current Energy

Vitality +25 points
Lunar Effect -2 points

Traits Breakdown

Body French Bulldog
Tail St. Bernard
Legs Husky
Front Legs Corgi
Head Beagle
Ears Shiba Inu
Snout Shiba Inu
Mouth Labrador
Nose Pug
Eyes French Bulldog
Color French Bulldog

Parents

No Children