Buster-Brown Billie Cryptocurrency Game Dog - Mix of Beagle, French Bulldog, Schnauzer, Labrador, Yorkshire Terrier, Pug, Shiba Inu and Pitbull terrier

Achievements

None
Buster-Brown Billie
Hey there... I'm Buster-Brown Billie. I love waking up early then indulging in long afternoon naps. I don't like thunder. I usually manage to scare it away with my vicious barks, but it always comes back again! My favorite song is "Who Let the Dogs Out?" It was me :)
  • Purity 4%
  • Age 31 days
  • Racing Exp 0
  • Beagle 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CTACCACGACTATTAGAAGTAATACGAATATCC
C
T
A
C
C
A
C
G
A
C
T
A
T
T
A
G
A
A
G
T
A
A
T
A
C
G
A
A
T
A
T
C
C
Genes: D59DF2EC9CN

Composition

Beagle
18%
French Bulldog
18%
Schnauzer
18%
Labrador
9%
Yorkshire Terrier
9%
Pug
9%
Shiba Inu
9%
Pitbull terrier
9%

Current Energy

Vitality -6 points
Lunar Effect 0 points

Traits Breakdown

Body Beagle
Tail Labrador
Legs French Bulldog
Front Legs Beagle
Head Yorkshire Terrier
Ears Pug
Snout Shiba Inu
Mouth Schnauzer
Nose French Bulldog
Eyes Schnauzer
Color Pitbull terrier

Parents

No Children