Butchy Biablo Litecoin Game Dog - Mix of Grey Wolf, Pitbull terrier, Golder Retriever, Yorkshire Terrier, Beagle, St. Bernard, Rottweiler, Boxer and Border Collie

Achievements

None
Butchy Biablo
I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I'll be honest...Napping is my favorite so we gotta go slow. I love it when you show a little teeth. I'm the best at running circle 8's. I don't understand why my human tries to give me tap water. I expect filtered and distilled!
  • Purity 7%
  • Age 31 days
  • Racing Exp 0
  • Grey Wolf 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCCCCTCCTCCAGATTACTATGACACAACTAC
C
C
C
C
C
C
T
C
C
T
C
C
A
G
A
T
T
A
C
T
A
T
G
A
C
A
C
A
A
C
T
A
C
Genes: LLNN8FDBHGJ

Composition

Grey Wolf
18%
Pitbull terrier
18%
Golder Retriever
9%
Yorkshire Terrier
9%
Beagle
9%
St. Bernard
9%
Rottweiler
9%
Boxer
9%
Border Collie
9%

Current Energy

Vitality +13 points
Lunar Effect -6 points

Traits Breakdown

Body Grey Wolf
Tail Grey Wolf
Legs Pitbull terrier
Front Legs Pitbull terrier
Head Golder Retriever
Ears Yorkshire Terrier
Snout Beagle
Mouth St. Bernard
Nose Rottweiler
Eyes Boxer
Color Border Collie