Amelie Arbiter Bitcoin Dog - Mix of Golder Retriever, St. Bernard, Grey Wolf, Maltese, Beagle, Labrador, Yorkshire Terrier and Pug

Achievements

None
Amelie Arbiter
Howdy! I'm Amelie Arbiter. I really enjoy heavy petting. Aggressive dogs that don't let 'me be me' frustrate me. Fences are just challenges...I don't let them stop me! Finding the 'one' out of the pack that I can spend my life with...that's what I want.
  • Purity 8%
  • Age 31 days
  • Racing Exp 0
  • Golder Retriever 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CCCAGAACCAGAAGACTATGACCATTATGAGAA
C
C
C
A
G
A
A
C
C
A
G
A
A
G
A
C
T
A
T
G
A
C
C
A
T
T
A
T
G
A
G
A
A
Genes: L8K88DB5FB2

Composition

Golder Retriever
27%
St. Bernard
18%
Grey Wolf
9%
Maltese
9%
Beagle
9%
Labrador
9%
Yorkshire Terrier
9%
Pug
9%

Current Energy

Vitality +16 points
Lunar Effect -2 points

Traits Breakdown

Body Grey Wolf
Tail Golder Retriever
Legs Maltese
Front Legs Golder Retriever
Head Golder Retriever
Ears Beagle
Snout St. Bernard
Mouth Labrador
Nose Yorkshire Terrier
Eyes St. Bernard
Color Pug

Parents

No Children