Anna Annie Cryptocurrency Game Dog - Mix of Border Collie, Yorkshire Terrier, Poodle, Labrador BK, Shiba Inu, Grey Wolf, Pug, Maltese, Golder Retriever and German Shepard

Achievements

None
Anna Annie
How goes it? I'm Anna Annie. I live inside of a web app in a big data center. Air Bud is definitely my favorite movie. What a role model! I'm going kill that damn Nyan Cat if I can catch it. It's okay with me just to touch paws while we watch t.v. on the couch if you want to start slow.
  • Purity 1%
  • Age 29 days
  • Racing Exp 0
  • Border Collie 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGACGCATACGTACCCGAATACACCAGATCA
T
T
A
G
A
C
G
C
A
T
A
C
G
T
A
C
C
C
G
A
A
T
A
C
A
C
C
A
G
A
T
C
A
Genes: FI6JEL2JK87

Composition

Border Collie
18%
Yorkshire Terrier
9%
Poodle
9%
Labrador BK
9%
Shiba Inu
9%
Grey Wolf
9%
Pug
9%
Maltese
9%
Golder Retriever
9%
German Shepard
9%

Current Energy

Vitality +35 points
Lunar Effect 0 points

Traits Breakdown

Body Yorkshire Terrier
Tail Poodle
Legs Labrador BK
Front Legs Border Collie
Head Shiba Inu
Ears Grey Wolf
Snout Pug
Mouth Border Collie
Nose Maltese
Eyes Golder Retriever
Color German Shepard

Parents

No Children