Debo Darla Cryptocurrency Dog - Mix of Corgi, Pitbull terrier, Golder Retriever, Husky, French Bulldog, Labrador, Dachshund and Shiba Inu

Achievements

None
Debo Darla
Nyan Cat is my best friend here in the cyberspace. The absolute best time of day is dinner time! I don't appreciate being around bores who bark too much. I would like to find someone that really appreciates the finer things in life: stinky socks, old tennis balls, toilet water, etc...
  • Purity 8%
  • Age 31 days
  • Racing Exp 0
  • Corgi 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: ACACGACCAAGCTCCTCCAGAAGAGGAGTAAGC
A
C
A
C
G
A
C
C
A
A
G
C
T
C
C
T
C
C
A
G
A
A
G
A
G
G
A
G
T
A
A
G
C
Genes: 495ONN88AEO

Composition

Corgi
18%
Pitbull terrier
18%
Golder Retriever
18%
Husky
9%
French Bulldog
9%
Labrador
9%
Dachshund
9%
Shiba Inu
9%

Current Energy

Vitality +39 points
Lunar Effect -14 points

Traits Breakdown

Body Husky
Tail French Bulldog
Legs Labrador
Front Legs Corgi
Head Pitbull terrier
Ears Pitbull terrier
Snout Golder Retriever
Mouth Golder Retriever
Nose Dachshund
Eyes Shiba Inu
Color Corgi

Parents

No Children