Polly Pikachu Cryptocurrency Game Dog - Mix of Dachshund, Rottweiler, French Bulldog, Labrador BK, Golder Retriever, Schnauzer, St. Bernard, Maltese, Border Collie and Shiba Inu

Achievements

None
Polly Pikachu
I've been known to run with bad dogs. I enjoy exploration and am game for anything doggy-style. I hate squeaky toys...when I finally get one to stop making that awful sound, my human buys another! I am looking for my best friend, lover, and equal partner to share my food bowl.
  • Purity 1%
  • Age 31 days
  • Racing Exp 0
  • Dachshund 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCGAGCAGGAAGAATAGGATGAACCTACGTA
C
A
C
C
G
A
G
C
A
G
G
A
A
G
A
A
T
A
G
G
A
T
G
A
A
C
C
T
A
C
G
T
A
Genes: H96A8CABKJE

Composition

Dachshund
18%
Rottweiler
9%
French Bulldog
9%
Labrador BK
9%
Golder Retriever
9%
Schnauzer
9%
St. Bernard
9%
Maltese
9%
Border Collie
9%
Shiba Inu
9%

Current Energy

Vitality +30 points
Lunar Effect -2 points

Traits Breakdown

Body Rottweiler
Tail French Bulldog
Legs Labrador BK
Front Legs Dachshund
Head Golder Retriever
Ears Schnauzer
Snout Dachshund
Mouth St. Bernard
Nose Maltese
Eyes Border Collie
Color Shiba Inu

Parents

No Children