Mario Masher Bitcoin Dog - Mix of Schnauzer, Corgi, Labrador, Pug, Pitbull terrier, Labrador BK and Golder Retriever

Achievements

None
Mario Masher
I'm a little said right now because my friend just got hit trying to dodge heavy web traffic. I am really into starting howling wars with the neighborhood dogs. I'm the loudest! Small yappy creatures bug me...they disturb my zen. Air Bud is definitely my favorite movie. What a role model!
  • Purity 9%
  • Age 29 days
  • Racing Exp 0
  • Schnauzer 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: GAAATAATAAGCTCCGCAATACCAAGACCAAGC
G
A
A
A
T
A
A
T
A
A
G
C
T
C
C
G
C
A
A
T
A
C
C
A
A
G
A
C
C
A
A
G
C
Genes: 2CCON6C585O

Composition

Schnauzer
27%
Corgi
18%
Labrador
18%
Pug
9%
Pitbull terrier
9%
Labrador BK
9%
Golder Retriever
9%

Current Energy

Vitality -2 points
Lunar Effect -6 points

Traits Breakdown

Body Pug
Tail Schnauzer
Legs Schnauzer
Front Legs Corgi
Head Pitbull terrier
Ears Labrador BK
Snout Schnauzer
Mouth Labrador
Nose Golder Retriever
Eyes Labrador
Color Corgi

Parents

No Children