Charlie Brown Callie Crypto Game Dog - Mix of Pug, Shiba Inu, St. Bernard, Beagle, Boxer, Husky, Rottweiler, German Shepard and Corgi

Achievements

None
Charlie Brown Callie
Hey dawg! I'm Charlie Brown Callie. Virtually, I'll come whenever you call. My human says I'm loyal, intelligent, devoted and affectionate. My humans should try spending 8 hours a day in a crate! Sometimes I forget where I buried my bone. My favorite thing is to sit in my humans' laps while they are trying to read or drive.
  • Purity 7%
  • Age 15 months
  • Racing Exp 0
  • Pug 18%
  • 0 races
  • Gen 0
Make him happy share it to your friend*
Depressed & Snaillike
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Coins
0.0 % wins (0) Breeding *** Coins
Scheduled races 0 Total *** Coins

DNA Analysis

DNA Sequence: GAATGACTAAACACACACGTAGTATCAAGCGAA
G
A
A
T
G
A
C
T
A
A
A
C
A
C
A
C
A
C
G
T
A
G
T
A
T
C
A
A
G
C
G
A
A
Genes: 2BDG4HEE7O2

Composition

Pug
18%
Shiba Inu
18%
St. Bernard
9%
Beagle
9%
Boxer
9%
Husky
9%
Rottweiler
9%
German Shepard
9%
Corgi
9%

Current Energy

Vitality -50 points
Lunar Effect 0 points

Traits Breakdown

Body Pug
Tail St. Bernard
Legs Beagle
Front Legs Boxer
Head Husky
Ears Rottweiler
Snout Shiba Inu
Mouth Shiba Inu
Nose German Shepard
Eyes Corgi
Color Pug