Wrigley Wallace Bitcoin Dog - Mix of Yorkshire Terrier, Pitbull terrier, Rottweiler, Beagle, Labrador, Corgi, Border Collie, Pug and French Bulldog

Achievements

None
Wrigley Wallace
I'm a huge fan of breakfast. And lunch. And dinner. Oh and don't forget brunch. And supper. And afternoon and midnight snacks... My favorite chews are underwear and rawhide...the rawhide lasts longer. I'm trying to find a dog who'll let me stick my nose where I want, whenever I want.
  • Purity 5%
  • Age 29 days
  • Racing Exp 0
  • Yorkshire Terrier 18%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: CACCTATTACCAAGCTTATACGAACGATCCTCC
C
A
C
C
T
A
T
T
A
C
C
A
A
G
C
T
T
A
T
A
C
G
A
A
C
G
A
T
C
C
T
C
C
Genes: HDF5OFJ29NN

Composition

Yorkshire Terrier
18%
Pitbull terrier
18%
Rottweiler
9%
Beagle
9%
Labrador
9%
Corgi
9%
Border Collie
9%
Pug
9%
French Bulldog
9%

Current Energy

Vitality +27 points
Lunar Effect +2 points

Traits Breakdown

Body Rottweiler
Tail Beagle
Legs Yorkshire Terrier
Front Legs Labrador
Head Corgi
Ears Yorkshire Terrier
Snout Border Collie
Mouth Pug
Nose French Bulldog
Eyes Pitbull terrier
Color Pitbull terrier

Parents

No Children