Sideline Spud Crypto Dog - Mix of Shiba Inu, Pitbull terrier, Pug, Yorkshire Terrier, Dachshund, Grey Wolf and St. Bernard

Achievements

None
Sideline Spud
Nice to meet you! I'm Sideline Spud. I really dislike stinky flea collars. I love waking up early then indulging in long afternoon naps. My favorite position is doggie style ;) I slept with a cat and I liked it. I'm looking for someone to share my collection of artisan rawhide with!
  • Purity 7%
  • Age 29 days
  • Racing Exp 0
  • Shiba Inu 27%
  • 0 races
  • Gen 0
Share it to make him Happy!
Ecstatic & Fast
Energy: ▂▃▅▆▇

Racing Stats

0 races   |
  • 0 0 0
 Best Time--
No rank  Racing *** Pts
0.0 % wins (0) Breeding *** Pts
Scheduled races 0 Total *** Pts

DNA Analysis

DNA Sequence: TTAGGAGTACCCTCCGTAGAATCCTGAGAAGTA
T
T
A
G
G
A
G
T
A
C
C
C
T
C
C
G
T
A
G
A
A
T
C
C
T
G
A
G
A
A
G
T
A
Genes: FAELNE2NB2E

Composition

Shiba Inu
27%
Pitbull terrier
18%
Pug
18%
Yorkshire Terrier
9%
Dachshund
9%
Grey Wolf
9%
St. Bernard
9%

Current Energy

Vitality +30 points
Lunar Effect +12 points

Traits Breakdown

Body Yorkshire Terrier
Tail Dachshund
Legs Shiba Inu
Front Legs Grey Wolf
Head Pitbull terrier
Ears Shiba Inu
Snout Pug
Mouth Pitbull terrier
Nose St. Bernard
Eyes Pug
Color Shiba Inu

Parents

No Children